Wegpunkt-Suche: 

archiviert

 
Rätselcache
Refo-Cache

 Refo-Cache

von FlensPiraten     Deutschland > Rheinland-Pfalz > Südliche Weinstraße

Achtung! Dieser Geocache ist „archiviert“! Es befindet sich kein Behälter an den angegebenen (oder zu ermittelnden) Koordinaten. Im Interesse des Ortes sollte von einer Suche unbedingt abgesehen werden!

N 49° 18.352' E 008° 08.060' (WGS84)

 andere Koordinatensysteme
 Größe: klein
Status: archiviert
 Versteckt am: 03. November 2016
 Veröffentlicht am: 03. November 2016
 Letzte Änderung: 19. Mai 2018
 Listing: https://opencaching.de/OC134BF

1 gefunden
0 nicht gefunden
0 Bemerkungen
3 Wartungslogs
1 Beobachter
0 Ignorierer
116 Aufrufe
0 Logbilder
Geokrety-Verlauf

große Karte

   

Infrastruktur
Wegpunkte
Zeitlich
Saisonbedingt
Benötigt Werkzeug
Benötigt Vorarbeit
Personen

Beschreibung   

Für diesen Cache suchen wir zunächst eine Person, die folgende DNA hinterlassen hat. ATGGCTCGTACTATTAATTTAACTCATGAACGT

(Anzahl Buchstaben des Vornamens x 3 = AB)



Wann ist diese Person geboren? (Jahreszahl = XXXX)

erste Ziffer + zweite Ziffer = D

dritte Ziffer minus 3 = F

letzte Ziffer = C



Wann wurde das wichtigste Werk der gesuchten Person erstmals vollständig abgedruckt? (Jahreszahl = XXXX)

Vorletzte Ziffer - 1 = K



In einem Gebäude des Ortes ist ein Bild der gesuchten Person zu finden. Wie heißt das Gebäude? (Kurzform)

Anzahl der Buchstaben + 2 = G



Was steht dort über der Eingangstür?

Anzahl der Buchstaben geteilt durch 5 = I



Wann wurde der Grundstein für dieses Gebäude gelegt? (Jahreszahl = XXXX)

Ersten beiden Zahlen minus 19 = L

Letzten beiden Zahlen minus 13 = H



Die Dose findet ihr bei N49.AB.CDF E008.LG.HIK

Verschlüsselter Hinweis   Entschlüsseln

Vz Wnue 2017 jveq rva tebßrf Whovyähz, qnf qvrfre Crefba mhmherpuara vfg, trsrvreg.

A|B|C|D|E|F|G|H|I|J|K|L|M
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

Hilfreiches

Dieser Geocache liegt vermutlich in den folgenden Schutzgebieten (Info): Biosphärenreservat Pfälzerwald (Info), Naturpark Pfälzerwald (Info)

Suche Caches im Umkreis: alle - suchbare - gleiche Cacheart
Download als Datei: GPX - LOC - KML - OV2 - OVL - TXT - QR-Code
Mit dem Herunterladen dieser Datei akzeptierst du unsere Nutzungsbedingungen und Datenlizenz.

Logeinträge für Refo-Cache    gefunden 1x nicht gefunden 0x Hinweis 0x Wartung 3x

OC-Team archiviert 08. Mai 2018 Schatzforscher hat den Geocache archiviert

Wie zuvor angekündigt erfolgt hier nun die Archivierung. Sollten sich später neue Aspekte ergeben, so kann dieses Listing durch den Owner selbstständig über ein "kann gesucht werden"-Log reaktiviert werden.

Bei Unklarheiten oder Fragen kannst du gerne mich oder das Team kontaktieren.

Schatzforscher (OC-Support)

OC-Team momentan nicht verfügbar Die Cachebeschreibung ist veraltet. 08. April 2018 Schatzforscher hat den Geocache deaktiviert

Die Beschreibung auf geocaching.com weicht von dieser hier ab: Frage zu Buchstabe I.

Die Nutzungsbedingungen von opencaching.de enthalten unter anderem diesen Punkt:

Ist der Geocache auch auf anderen Webseiten veröffentlicht, so muss die Beschreibung immer auf allen Webseiten aktuell und vollständig gehalten werden. Aktualisierungen der Beschreibung müssen zeitnah auch auf den anderen Plattformen vorgenommen werden.

Der Owner sollte hier dringend das Listing dem aktuellen Stand anpassen, so dass sein Cache auch hier wieder gefunden werden kann; bis dahin setze ich den Status auf "Momentan nicht verfügbar". Sollte innerhalb eines Monats (d.h. 08.05.2018) keine Rückmeldung erfolgen, werde ich den Cache archivieren

Bei Unklarheiten oder Fragen kannst du gerne mich oder das Team kontaktieren.

Schatzforscher (OC-Support)

gefunden Der Cache ist in gutem oder akzeptablem Zustand. 23. Mai 2017, 10:45 sierrakilo hat den Geocache gefunden

Da ist einem das Döschen fast vor die Füße gefallen. Stirnrunzeln hat allerdings die Frage nach der Anzahl der Buchstaben über der Eingangstür bereitet. Das, was da tatsächlich über dem Eingang steht, läßt sich nicht ohne Rest durch 5 dividieren. Nimmt man allerdings das kleine Faltblatt der Einrichtung zur Hand, dann fehlt dort ein Wort, aber dann klappt's. Die Einrichtung ist nicht immer geöffnet; ich hatte gerade noch Glück.

kann gesucht werden 03. November 2016, 07:30 FlensPiraten hat den Geocache gewartet

Los gehts... auf den Spuren von....