Waypoint-zoeken: 

Gearchiveerd

 
Puzzel cache
Refo-Cache

 Refo-Cache

door FlensPiraten     Duitsland > Rheinland-Pfalz > Südliche Weinstraße

Attentie! Deze cache is "Gearchiveerd"! Er bevind zich geen behuizing op de aangegeven (of uitgerekende) coördinaten. Het is dan ook raadzaam om deze cache niet te gaan zoeken!

N 49° 18.352' E 008° 08.060' (WGS84)

 andere coördinaatstelsel
 Grootte: klein
Status: Gearchiveerd
 Verborgen op: 03. november 2016
 Published on: 03. november 2016
 Laatste verandering: 19. mei 2018
 Listing: https://opencaching.de/OC134BF

1 Gevonden
0 Niet gevonden
0 Opmerkingen
3 Maintenance logs
1 Watcher
0 Negeerders
116 Bekeken
0 Log pictures
Geokrety verleden

Large map

   

Infrastructuur
Waypoints
Time
Seasonal
Tools needed
Preparation needed
Personen

Beschrijving    Deutsch (Duits)

Für diesen Cache suchen wir zunächst eine Person, die folgende DNA hinterlassen hat. ATGGCTCGTACTATTAATTTAACTCATGAACGT

(Anzahl Buchstaben des Vornamens x 3 = AB)



Wann ist diese Person geboren? (Jahreszahl = XXXX)

erste Ziffer + zweite Ziffer = D

dritte Ziffer minus 3 = F

letzte Ziffer = C



Wann wurde das wichtigste Werk der gesuchten Person erstmals vollständig abgedruckt? (Jahreszahl = XXXX)

Vorletzte Ziffer - 1 = K



In einem Gebäude des Ortes ist ein Bild der gesuchten Person zu finden. Wie heißt das Gebäude? (Kurzform)

Anzahl der Buchstaben + 2 = G



Was steht dort über der Eingangstür?

Anzahl der Buchstaben geteilt durch 5 = I



Wann wurde der Grundstein für dieses Gebäude gelegt? (Jahreszahl = XXXX)

Ersten beiden Zahlen minus 19 = L

Letzten beiden Zahlen minus 13 = H



Die Dose findet ihr bei N49.AB.CDF E008.LG.HIK

Gecodeerde hint   Decoderen

Vz Wnue 2017 jveq rva tebßrf Whovyähz, qnf qvrfre Crefba mhmherpuara vfg, trsrvreg.

A|B|C|D|E|F|G|H|I|J|K|L|M
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

Hulpmiddelen

This geocache is probably placed within the following protected areas (Info): Biosphärenreservat Pfälzerwald (Info), Naturpark Pfälzerwald (Info)

Zoek caches in de omgeving: alle - zoekbaar - zelfde cache soort
Download als bestand: GPX - LOC - KML - OV2 - OVL - TXT - QR-Code
When downloading this file, you accept our terms of use and Data license.

Logs van Refo-Cache    Gevonden 1x Niet gevonden 0x Opmerking 0x Maintenance 3x

OC-Team Gearchiveerd 08. mei 2018 Schatzforscher has archived the cache

Wie zuvor angekündigt erfolgt hier nun die Archivierung. Sollten sich später neue Aspekte ergeben, so kann dieses Listing durch den Owner selbstständig über ein "kann gesucht werden"-Log reaktiviert werden.

Bei Unklarheiten oder Fragen kannst du gerne mich oder das Team kontaktieren.

Schatzforscher (OC-Support)

OC-Team Tijdelijk niet beschikbaar The geocache description is outdated. 08. april 2018 Schatzforscher has disabled the cache

Die Beschreibung auf geocaching.com weicht von dieser hier ab: Frage zu Buchstabe I.

Die Nutzungsbedingungen von opencaching.de enthalten unter anderem diesen Punkt:

Ist der Geocache auch auf anderen Webseiten veröffentlicht, so muss die Beschreibung immer auf allen Webseiten aktuell und vollständig gehalten werden. Aktualisierungen der Beschreibung müssen zeitnah auch auf den anderen Plattformen vorgenommen werden.

Der Owner sollte hier dringend das Listing dem aktuellen Stand anpassen, so dass sein Cache auch hier wieder gefunden werden kann; bis dahin setze ich den Status auf "Momentan nicht verfügbar". Sollte innerhalb eines Monats (d.h. 08.05.2018) keine Rückmeldung erfolgen, werde ich den Cache archivieren

Bei Unklarheiten oder Fragen kannst du gerne mich oder das Team kontaktieren.

Schatzforscher (OC-Support)

Gevonden The geocache is in good or acceptable condition. 23. mei 2017, 10:45 sierrakilo heeft de cache gevonden

Da ist einem das Döschen fast vor die Füße gefallen. Stirnrunzeln hat allerdings die Frage nach der Anzahl der Buchstaben über der Eingangstür bereitet. Das, was da tatsächlich über dem Eingang steht, läßt sich nicht ohne Rest durch 5 dividieren. Nimmt man allerdings das kleine Faltblatt der Einrichtung zur Hand, dann fehlt dort ein Wort, aber dann klappt's. Die Einrichtung ist nicht immer geöffnet; ich hatte gerade noch Glück.

Beschikbaar 03. november 2016, 07:30 FlensPiraten has maintained the cache

Los gehts... auf den Spuren von....